PRODUCT CENTER
SYBR Green qRT-PCR Master Mix
    Publish time 2018-09-27 19:50    

This product is a 2 × Master Mix for "one step qRT-PCR" using a  hot strart rTth DNA polymerase , which exhibits reverse transcriptase activity in the presence of Mn2+ ions. The master mix  allows for "one step qRT-PCR", including reverse transcription and PCR steps. This reagent can be applied to an intercalation assay with SYBR Green I.

SYBR Green qRT-PCR Master Mix

Description

  This product is a 2 × Master Mix for "one step qRT-PCR" using a  hot strart rTth DNA polymerase , which exhibits reverse transcriptase activity in the presence of Mn2+ ions. The master mix  allows for "one step qRT-PCR",  including reverse transcription and PCR steps. This reagent can be applied to an intercalation assay with SYBR Green I

Storage:    

   This reagent  his reagent can be stored at 4°C for 2 months and protected from light.
   For longer storage,  this reagent should be kept at -20°C and protected from light. 

Components

This reagent includes the following components   for 100 reactions  with a total of 50 µL per reaction, or for 250 reactions with a total 20ul per reaction.

                                


SYBR Green qRT- PCR Master Mix                                    

0.5ml x 5tubes

50mM Mn(OAc)2

0.5ml x 1tube


Detection    

   -This reagent can be used in general detection devices, not needing ROX such as:
   -LineGene(bioer);LightCycler (Roche);  iCycler iQ,CFX 96(Biorad/MJ);Thermal Cycler Dice(Takara);
   -This reagent with 1X ROX  can also be used in detection equipment using passive reference, such as:
   -ABI PRISM® 7000, 7700, 7900 ,7300;Step One,Step one plusetc.(ABI) ,ABI PRISM® 7500,etc;
   -This reagent  can not  be used in detection equipment using 0.1X ROX passive reference, such as: 
Mx3000P,3005P,MX4000,etc.(Agilent) 

 

Primer design

-Primer length: 20~30 mer
-GC content of primer: 40~60%
-Target length: ≤ 200 bp (optimally, ≤ 150bp) 

Specimen
Total RNA: Total RNA typically contains 1~2% mRNA, which can be used as template directly with this kit. RNA can be  prepared by the Trizol or  the spin column method contains genomic DNA; therefore, the total RNA should be treated with DNase I prior to transcription.
Poly(A)+ RNA:Poly(A)+ RNA can be used to detect low-level expressing mRNA. However, poly(A)+ RNA should be treated carefully, because Poly(A)+ RNA is more sensitive to RNase than total RNA. 
 
Protocol 
-All  solutions  should  be  thawed  on ice,gently vortexed and  briefly   centrifuged.
-Prepare  the   following  reaction   in   a   thin-walled  qPCR tube  or plate on  ice.



-Gently  mix  the   reaction   solutions   and   spin down in microcentrifuge.


Cycling conditions 



Notes 

-Primer concentrations can be further optimized, if needed. The optimal range of primers is 0.2~0.6uM. In the case of commercially available primers, those recommended condition should be used.
-The final concentration of Mn(OAc)2 should be adjusted to 2~3.5 mM.
- The first denaturation step (90°C, 30 sec.) is sufficient to inactivate the antibodies. Do not prolong this denaturation step.
-The annealing temperature should to Tm-5 °C. The optimal annealing temperature range is 55-65°C
-The temperature transition rate should be set to 20 °C/sec. Pool amplification may be improved by adjusting the temperature transition rate to 2 °C/sec.
-If the target length is ≤ 200 bp, the extension time should be adjusted to 15 sec. Data collection steps should be at least 15 sec. .
 

 Example 
Target Gene  :  Bacillus badius phenylalanine dehydrogenase  gene in pET28a plasmid

Primer

       Forward primer  AGGAAGCCGATGTGTTCGTT 

       Reverse primer TTCCGCTTGCTGGTACACTT

       Competitor Company T 2×SYBR Green  qPCR Master Mix

       Instrument model ABI 7500

  Amplification curve
     


Melting curve




   





Ordering Information

  Cat.No.
  Product Name
    Size 
     Store at 
  Price
   Data Sheet
 QPR-200
  SYBR Green qRT-PCR Master Mix  
 0.5ml×5tube
  Store at -20°C and protected from light.  
  US$  250.00
    
QPR-200-Bulk
 0.5ml×1000tube
 US$   25000.00