
TOROBlue® qRT Premix with gDNA Eraser enables fast cDNA synthesis for 2-step RT-qPCR and includes a rapid step that eliminates genomic DNA contamination without loss of input RNA. Genomic DNA is eliminated by treating the RNA templates with gDNA Eraser Mix for 2-5 minutes at 37°C. 5×qRT Premix contains primers and buffer optimized for highly efficient synthesis of short-chain cDNAs suitable for qPCR. The protocol is simple, and the reaction can be completed in 10-25 min.





DESCRIPTION
TOROBlue® qRT Premix with gDNA Eraser enables fast cDNA synthesis for 2-step RT-qPCR and includes a rapid step that eliminates genomic DNA contamination without loss of input RNA. Genomic DNA is eliminated by treating the RNA templates with gDNA Eraser Mix for 2-5 minutes at 37°C. 5×qRT Premix contains primers and buffer optimized for highly efficient synthesis of short-chain cDNAs suitable for qPCR. The protocol is simple, and the reaction can be completed in 10-25 min. .
COMPONENTS
The kit includes the following reagents,which can be used for 100 reactions for a total 10µl reaction volume.
Cat NO :RTQ-201
RNA Dilution Buffer 1ml/tube
gDNA Eraser Mix 200µl/tube
5×qRT Premix 200 µl/tube
RT Enzyme Mix 100µl /tube
Notes:
-RNA Dilution Buffer can be used to dilute and store RNA instead of RNase-free water.
- gDNA Eraser Mix contains Heat labile dsDNA Nuclease, RNase inhibitor, and reaction buffer.
- 5×qRT Premix contains oligo dT primer, random primer, and reaction buffer.
-RT Enzyme Mix contains the highly efficient reverse transcriptase and an RNase inhibitor.
PROTOCOL
1. Preparation of the reagent and templates
-This kit should be fully thawed before use. Gently vortexed and briefly centrifuged.
-Purified template RNA can be may be used directly or after dilution。
2. Genomic DNA elimination reaction
-Prepare the following reaction in a thin-walled PCR tube one the ice.
Component | Volume |
gDNA Eraser Mix | 2 µL |
Total RNA | X µL |
RNA Dilution Buffer | 5-XµL |
Total | 7µL |
-Incubate at 37℃ for 5 min. Store the reaction tube one ice.
Notes:
-The indicated time of gDNA elimination reaction is between 2-5min at 37℃.
-Up to 0.5μg of total RNA template for qPCR assay.
3. Reverse-transcription
-Transfer 2μL 5×qRT Premix and 1μL RT Enzyme Mix into the above reaction tube. Gently vortexed and
briefly centrifuged.
-RT reaction as the following condition.
37℃ 15min
50℃ 5min
98℃ 5 min
-Store the reaction tube one ice.
Notes:
-The cDNA products can be used directly or after dilution for real-time PCR. Up to 20% of the synthesized cDNA solution can be added to the PCR reaction solution.
-The mutant M-MLV reverse transcriptase excels at high reaction temperatures (up to 60℃). This step may increase the efficiency of the reverse transcription.
APPLICATION DATA
1. Efficiency of gDNA elimination.
RT Reagent: TOROBlue® qRT Premix with gDNA Eraser(RTQ-201)
Template: Human Genomic DNA 50ng/reaction
Experiment groups:
-Store the reaction tube one ice.
| 4×gDNA Eraser Mix | 5×qRT Premix | RT Enzyme Mix |
A | (+) | (+) | (-) |
B | (-) | (+) | (-) |
qPCR Reagent: TOROGreen®qPCR Master Mix (Code No.QST-100).
Template: cDNA 2μL/20μLreaction
Target:GAPDH (Non cross-intron)
Forward primer:AAAAGGGCCCTGACAACTCTT
Reverse primer:GTCTTACTCCTTGGAGGCCA
Instrument : CFX-96 from Biorad
Results:
No signal for the“A groups”indicates that 50ng gDNA was completely removed by gDNA Eraser.
2.Comparison of RT performance
RT Reagent: TOROIVD® qRT Master Mix(RTQ-100).
TOROBlue® qRT Premix with gDNA Eraser(RTQ-201)
Template: Template RNA:MS2RNA (Roche)
Forward primer: GCCTTAGCAGTGCCCTGTCT
Reverse primer:AACATGCTCGAGGGCCTTA
qPCR Reagent: TOROGreen®qPCR Master Mix (Code No.QST-100).
Template: cDNA 2 μL/20 μLreaction
Instrument : CFX-96 from Biorad
Results:

Despite the gDNAcontamination, the results of RTQ-201 correlate highly with those of the RTQ-100. Both reagents showed highly linear standard curves in a broad concentration range
STORAGE
This reagent should be kept at -20°C for 1 years.
ORDER INFORMATION
Cat NO. | Product Name | Componments | Size | Literature |
RTQ-201 | RNA Dilution Buffer ,1ml RT Enzyme Mix,100µl gDNA Eraser Mix, 200µl 5×qRT Premix , 200 µl
| 100reactions for a total 10ul reaction |
Bulk package can be supplied,please contact us .