TOROIVD TECHNOLOGY 

    COMPANY LIMITED

Evolving Enzymes  

   Inovating IVD

MORE
PRODUCT CENTER
RNA Dilution&Storage Solution
    Publish time 2021-03-17 10:38    

RNA Dilution&Storage Solution is a buffer that provides greater RNA stability than TE Buffer or RNase-free water. The last step in every RNA isolation protocol is to resuspend the purified RNA pellet. After painstakingly isolating the RNA, it is crucial that the pellet be suspended and stored in a safe, RNase-free solution.RNA Dilution&Storage Solution has two features that keeps RNA stable: a low pH of 7.0, and a Chemical RNase Inhibitor. RNA Dilution&Storage Solution Solution is compatible with all common RNA applications such as reverse transcription, RT-PCR,   1- step RT-qPCR, in vitro transcription, northern analysis, and nuclease protection assays.  

DESCRIPTION

RNA Dilution&Storage Solution is a buffer that provides greater RNA stability than TE Buffer or RNase-free water. The last step in every RNA isolation protocol is to resuspend the purified RNA pellet. After painstakingly isolating the RNA, it is crucial that the pellet be suspended and stored in a safe, RNase-free solution.RNA Dilution&Storage Solution has two features that keeps RNA stable: a low pH of 7.0, and a Chemical RNase Inhibitor. RNA Dilution&Storage Solution Solution is compatible with all common RNA applications such as reverse transcription, RT-PCR,   1- step RT-qPCR, in vitro transcription, northern analysis, and nuclease protection assays.

Components

RNA Dilution&Storage Solution

RDB-100                                 100ml           

APPLICATIONS

-RNA Dilution

This product can be used to dilute RNA instead of RNase-free water(such as DEPC treated water) in all RNA applications such as cDNA synthesis ,RT-PCR,   1- step RT-qPCR, in vitro translation&transcription northern analysis, and nuclease protection assays.  
-RNA Storage

This product can be used to dilute and store RNA instead of RNase-free water or TE Buffer, and can keep

RNA more stable in room temperature.

APPLICATION DATA 

Dilution Solution

A: RNA Dilution&Storage SolutionTOROIVD

B:The RNA Storage SolutionCompany T 

Template :

Add 50μl 0.8ng MS2RNA 1 ml of the above two solutions (from TOROIVD and Company T) respectively and  store at 25and 37.

Primer and Probe

Forward primer:GCCTTAGCAGTGCCCTGTCT 400nM
Reverse primer:AACATGCTCGAGGGCCTTA   400nM

TaqmanProbe:FAM-CCCGTGGGATGCTCCTACATGTCA-TAMRA 200nM

qPCR Reagent:

TOROIVD® Probe 1-step RT-qPCR 5G Kit 2.0

Instrument

ABI-7500

Results:

     

 

 Fig 1. The RNA template amount in the two  two solutions was basically the same.






    

Fig 2. RNA Dilution&Storage Solution from TOROIVD keeps RNA more stable at 25or 37for 3days than the RNA Storage Solution from Company T.

STORAGE

This product should be kept at 2-8 for 12 months.


HOW TO BUY PRODUCTS