TOROIVD TECHNOLOGY 

    COMPANY LIMITED

Evolving Enzymes  

   Inovating IVD

MORE
PRODUCT CENTER
TOROBlue® qRT Premix with gDNA Eraser
    Publish time 2021-03-17 10:12    

TOROBlue® qRT Premix with gDNA Eraser enables fast cDNA synthesis for 2-step RT-qPCR and includes a rapid step that eliminates genomic DNA contamination without loss of input RNA. Genomic DNA is eliminated by treating the RNA templates with gDNA Eraser Mix for 2-5 minutes at 37°C. 5×qRT Premix contains  primers and buffer optimized for highly efficient synthesis of short-chain cDNAs suitable for qPCR. The protocol is simple, and the reaction can be completed in 10-25 min.   

DESCRIPTION

TOROBlue® qRT Premix with gDNA Eraser enables fast cDNA synthesis for 2-step RT-qPCR and includes a rapid step that eliminates genomic DNA contamination without loss of input RNA. Genomic DNA is eliminated by treating the RNA templates with gDNA Eraser Mix for 2-5 minutes at 37°C. 5×qRT Premix contains  primerand buffer optimized for highly efficient synthesis of short-chain cDNAs suitable for qPCR. The protocol is simple, and the reaction can be completed in 10-25 min.                     .

 

COMPONENTS

 

The kit includes the following reagents,which can be used for 100 reactions for a total 10µl reaction volume.
Cat NO RTQ-201   

RNA Dilution Buffer               1ml/tube

gDNA Eraser Mix                  200µl/tube              

5×qRT Premix                     200 µl/tube 

RT Enzyme Mix                     100µl /tube 

Notes:

-RNA Dilution Buffer can be used to dilute and store RNA instead of RNase-free water.  

gDNA Eraser Mix contains Heat labile dsDNNuclease, RNase inhibitor, and reaction buffer.  

5×qRT Premix contains oligo dT primer, random primer, and reaction buffer.    

-RT Enzyme Mix  contains the highly efficient reverse transcriptase and an RNase inhibitor. 

 

PROTOCOL

 

1. Preparation of the reagent and templates

-This kit should be fully thawed before use. Gently vortexed and briefly centrifuged. 

-Purified template RNA can be may be used directly or after dilution。 


2. 
Genomic DNA elimination reaction

-Prepare the following  reaction in a thin-walled PCR  tube one the ice.

 

Component

Volume

gDNA Eraser Mix

2 µL

Total RNA

µL

RNA Dilution Buffer

5-XµL

Total

7µL

 

-Incubate at 37℃ for 5 min. Store the reaction tube one ice.


Notes:

-The indicated  time of  gDNA elimination reaction is between 2-5min at 37.

-Up to 0.5μg of total RNA template for qPCR assay.


3.
 Reverse-transcription 

-Transfer 2μ5×qRT Premix and 1μRT Enzyme Mix into the above reaction tube. Gently vortexed and 

briefly centrifuged. 

-RT reaction as the following condition.

37℃    15min 

50℃    5min 

98℃   5 min

-Store the reaction tube one ice.


Notes:
-The cDNA products can be used directly or after  dilution for real-time PCR. Up to 20% of the synthesized cDNA solution can be added to the PCR reaction solution.
 
-The mutant M-MLV reverse transcriptase excels at high reaction temperatures (up to 60). This step may increase the efficiency of the reverse transcription. 


APPLICATION DATA

 

1. Efficiency of gDNA elimination.

  
RT Reagent: TOROBlue® qRT Premix with gDNA EraserRTQ-201

Template: Human Genomic DNA 50ng/reaction

Experiment groups:

 

4×gDNA Eraser Mix

5×qRT Premix 

RT Enzyme Mix

A

(+)

(+)

(-)

B

(-)

(+)

(-)


   qPCR Reagent:  
TOROGreen®qPCR Master Mix (Code No.QST-100).

Template: cDNA 2μL/20μLreaction

Target:GAPDH (Non cross-intron)

Forward primerAAAAGGGCCCTGACAACTCTT

Reverse primerGTCTTACTCCTTGGAGGCCA

Instrument  CFX-96 from Biorad

Results

 


 
   No signal for theA groupsindicates that 50ng gDNA was completely removed by gDNA Eraser.


2
.Comparison of RT performance

RT Reagent: TOROIVD ® qRT Master Mix(RTQ-100).

TOROBlue® qRT Premix with gDNA EraserRTQ-201

Template: Template RNA:MS2RNA (Roche)

 Forward primer: GCCTTAGCAGTGCCCTGTCT
   Reverse primer:AACATGCTCGAGGGCCTTA
   qPCR Reagent:  TOROGreen®qPCR Master Mix (Code No.QST-100).

Template: cDNA 2 μL/20 μLreaction

Instrument  CFX-96 from Biorad

Results



   


 

 Despite the gDNAcontamination, the results of RTQ-201 correlate highly with those of the RTQ-100. Both reagents showed highly linear standard curves in a broad concentration range.


STORAGE

 

This reagent should be kept at -20°C for 1 years.



ORDER INFORMATION
 

Cat NO.

Product Name

Componments

Size

Literature

 RTQ-201

TOROBlue® qRT Premix with gDNA Eraser 

RNA Dilution Buffer ,1ml

RT Enzyme Mix,100µl

gDNA Eraser Mix, 200µl      5×qRT Premix , 200 µl 

100reactions

for a total

10ul reaction


 Manual


Bulk package can be supplied
please contact us .


HOW TO BUY PRODUCTS