TOROIVD TECHNOLOGY 

    COMPANY LIMITED

Evolving Enzymes  

   Inovating IVD

MORE
PRODUCT CENTER
TOROIVD® Probe 1-step RT-qPCR 5G kit 2.0
    Publish time 2020-08-07 12:52    

TTOROIVD® Probe 1-step RT-qPCR 5G kit 2.0 provides for sensitive, reproducible detection up to five RNA and ssDNA targets in a single multiplex reaction .Particularly useful for virus detection with TaqMan®probe assays , the kit includes UNG, dsDNasethermostable MMLV reverse transcriptase, RNase inhibitor ,TOROIVD® 5G DNA polymerase and reaction buffer.  The improved enzymes also enables a high resistance to PCR inhibitors and high stability in room temperature. The 1-step system is suitable for high-throughput analysis because of its simple reaction setup. In addition, this system can reduce the risk of cross-contamination with Uracil-N-glycoslyaseUNGand dsDNase. The kit is suitable for high-speed RT-qPCR and enables accurate detection and quantification of targets, making it possible to obtain highly reproducible and reliable realtime PCR results over a wide dynamic range.  



DESCRIPTION

TOROIVD® Probe 1-step RT-qPCR 5G kit 2.0 provides for sensitive, reproducible detection up to five RNA and ssDNA targets in a single multiplex reaction .Particularly useful for virus detection with TaqMan®probe assays , the kit includes UNG, dsDNasethermostable MMLV reverse transcriptase, RNase inhibitor ,TOROIVD® 5G DNA polymerase and reaction buffer.  The improved enzymes also enables a high resistance to PCR inhibitors and high stability in room temperature. The 1-step system is suitable for high-throughput analysis because of its simple reaction setup. In addition, this system can reduce the risk of cross-contamination with Uracil-N-glycoslyaseUNGand dsDNase. The kit is suitable for high-speed RT-qPCR and enables accurate detection and quantification of targets, making it possible to obtain highly reproducible and reliable realtime PCR results over a wide dynamic range.  

Features

-Rapid and highly sensitive
This kit can achieve the rapid and highly sensitive quantification of a low-copy targets  by a 1-step RT-qPCR method with probes and be suitable for the quantification of RNA/ssDNA viruses or mRNA expressed at a low level. 

-Optimized for multiplexing
This kit has been validated for multiplexing up to five targets simultaneously, allowing for additional targets and/or controls to be run simultaneously for efficiency or quality control purposes. 

-Inhibitor tolerant
The unique proprietary formulation of this kit allows robust performance even in the presence of substances that can normally inhibit PCR, such as heparin, hematin, or EDTA, increasing your confidence when working with a variety of complex clinical samples. 

-Wide dynamic range compatible with RNA and ssDNA
This kit has been optimized to provide high specificity and dynamic range for use with both RNA and ssDNA targets. This input flexibility can help streamline the number of different workflows in your lab to improve efficiency. 

-Broad instrument compatibility
This kit can be run in either fast or standard cycling conditions with equivalent performance across a wide variety of real-time cyclers. The 50×ROX Reference dyenot suppliedis added can be applied to the real-time cyclers that require a passive reference dye. 

-Avoid Contamination

This kit contains dUTP in the reaction buffer and UNG and  small amounts of dsDNase in the enzyme mix. The crossed contamination caused by PCR product or dsDNA can be removed so that the rate of false-positive detection can be reduced.    

Components

The kit includes the following  reagents, and QPR-303UD can be used for 400 reactions for a total 25μl reaction volume. All reagents should be stored at −20°C. 

Cat NO.

Components

Size

QPR303UD13

RT-qPCR Enzyme Mix UD

260μl/tube×2  

ASF104BB

2×5G qPCR Buffer BB 

1ml/tube×5 

       

Notes: -RT-qPCR Enzyme Mix UD contains UNG, dsDnase,TOROIVD®III reverse transcriptase, RNase inhibitor and TOROIVD®5G DNA polymerase. -2×5G qPCR Buffer BB  contains 0.4mM dA/C/G/T/UTP, 5mM Mg2+reaction buffer and stabilizeretc.). 

Not supplied

In some experimental applications, the following reagents may be used with  QPR-303UD,which are not supplied in this kit. Please contact us to order.

 

Cat NO.

Components

Size

END-UD13

 Enzyme Mix Dilution Buffer

1ml/tube

ASF101GB

2×5G qPCR Buffer GB 

1ml/tube 

ROX-050

50×ROX Reference dye

100μl/tube

 

Notes: 

-Enzyme Mix Dilution Buffer is used to dilute the RT-qPCR Enzyme Mix UD without changing the performance and stability of the Enzyme Mix. And the Maximum added volume is 1ml for per ml Enzyme Mix UD.

-2×5G qPCR Buffer GB can also be used instead of 2×5G qPCR Buffer BB in the kit for some experimental applications with higher sensitivity and specificity.

-The 50× ROX reference dyes are used for analyses with instruments that correct for cross-talk between wells, such as the real- time PCR instruments by Applied Biosystems and Agilent Technologies. 0.5μl 50×ROX Reference Dye was added for a total 25μl reaction volume in when using the following instruments,Applied Biosystems 7300/ 7700/7900HT, StepOnePlus, etc. And 0.05 μl  was added for using the following instruments,Applied Biosystems 7500/7500Fast StepOnePlus ,Agilent Technologies AriaMx,etc.No ROX Reference Dye is required when using other brand instruments,such as LightCycler 96/LightCycler 480 system (Roche), CFX96 Real-Time PCR Detection System (Bio-Rad), Smart Cycler System (Cepheid) ,etc.


Primer/probe design 

 -Design of primers 

Primer length: 18–25bpGC content of primer: 40–60%

Tm of primer: 60–65°CPurification grade: OPC or HPLC grade 

Target length: 70–200 bp Larger targets (>200 bp) tend to reduce the efficiency and specificity of amplification. 

 - Design of  probes
  -Probe length: 20–30bpGC content of probe: 40–60%

Tm of probe: 65–70°CPurification grade : HPLC grade.  

- Checking the performance of primers and probes

-Prepare a dilution series with five or more dilutions of template RNA/ssDNA. Perform RT-qPCR assay using the diluted RNA/ssDNA with the newly designed primers and probe, and draw a standard curve. 

- Confirm that the PCR efficiency is between 90% and 110% and R2 is equal to or greater than 0.99. if the PCR efficiency or R2 are outside of these ranges, the reaction conditions should be optimized. If this does not improve the result, the primers and/or probe should be redesigned. 
 

Protocol 

1. This kit should be fully thawed before use. Gently vortexed and briefly centrifuged. 

2. Purified or crude template RNA/ssDNA can be may be used directly or after dilution

3. Prepare the following reaction mixture in a thin-walled qPCR tube or plate.

 

Components               25μl reaction

2×5G qPCR Buffer BB                       12.5μl

 

 

 

 

Premix 

RT-qPCR Enzyme Mix UD                   1.3μl

10μM Forward primer                         1μl

10μM Reverse primer                          1μl

10μM TaqMan® probe                      0.4μl

50×ROX                                   0/0.05/0.5μl

DNase/Rnase Free Water                     Xul

  Template RNA/ssDNA solution             5μl                   

 

4. Gently mix the  reaction solutions  and spin down in microcentrifuge.

 

Notes 

- For the direct RT-qPCR to crude template RNA, the MgCl2 concentration 

may need to be optimized between 2.5-8mM of final concentration. BSA and Triton X-100 may need to be added to improve the performance of direct RT-qPCR.
-The primer concentration should be optimized between 0.2-0.8 μM and  TaqMan® probe optimized between 0.1-0.4 μM  with 10-50 copies templates /reaction . So the best primers-probe concentration sets was selected by orthogonal design of experiments .


Cycling conditions 

The recommended 2-step PCR protocol is described below. Use this protocol first and optimize PCR conditions when necessary. Perform 3-step PCR when using primers with low Tm values or when 2-step PCR is not feasible.

UNG&dsDNase treatment:      37°C            2min            1cycle  

Reverse transcription           52°C            5min            1cycle

Pre-denaturation                  95°C            2min           1cycle

 Denaturation                      95°C          10sec           40cycles      

Extension /Annealing            60°C            30sec          40cycles

Data collection should be performed at the extension step. 

 

Note 

-The indicated RT temperature can be optimized between 50-60°C and time  between 2-15min

-The indicated Pre-denaturation temperature can be optimized 95-98°Cand time between 2min-5min

-The indicated denaturation temperature can be optimized 95-98°Cand time between 3sec-10sec

-The indicated Extension /Annealing temperature can be optimized 60-65°Cand time between 5sec-30sec

 

Application data 


Example 1.
  High sensitivity detection of 2-3 copies SARS-CoV-2 reference RNA.

Template RNA: 

SARS-CoV-2 reference RNAGBWE091111China);

N Gene2.4×105copies/ul; E Gene1.8×105copies/ul;ORF1ab Gene0.70×105copies/ulDilution factor is 103104105106.

Primer and ProbeFrom China CDC

ORF1ab-F5`- CCCTGTGGGTTTTACACTTAA-3`  300nM

ORF1ab-R 5`- ACGATTGTGCATCAGCTGA-3`   300nM

ORF1ab-P: 5`-FAM-CCGTCTGCGGTATGTGGAAAGGTTATGG-3`BHQ1  100nM

N-F: 5`- GGGGAACTTCTCCTGCTAGAAT-3`  600nM

N-R: 5`- CAGACATTTTGCTCTCAAGCTG-3`  600nM

N-P: 5`-FAM-TTGCTGCTGCTTGACAGATT-3`TAMRA  200nM

Instrument

Line Gene 9600 Plus Bioer.


Example 2.
  LOD  comparison with Company N

Template RNA: 

   2.25copies /reaction  of ORF1ab Gene,20 replicates

   2.75copies /reaction  of N Gene,20 replicates

  Instrument

ABI 7500
   
                           ORF -QPR-303UD20/20

                    ORF -Company N14/20

 

  
                                             N -QPR-303UD20/20           



                
N -Company N13/20

Example 3.   Contamination removal capacity of QPR-303UD

  Template: Purified PCR product by MS2RNA and QPR-303UD 

  Primer and Probe

Forward primer:GCCTTAGCAGTGCCCTGTCT  400nM
   Reverse primer:AACATGCTCGAGGGCCTTA  400nM
  Taqman Probe:FAM-CCCGTGGGATGCTCCTACATGTCA-TAMRA 200nM

Instrument

CFX 96

 

     Greenwithout UNG   BlueQPR-303UD

Example 4. Thermal stability of  QPR303UD13 Enzyme Mix

Template: MS2RNA from Roche

Primer and Probe

Forward primer:GCCTTAGCAGTGCCCTGTCT  400nM
   Reverse primer:AACATGCTCGAGGGCCTTA  400nM
  Taqman Probe:FAM-CCCGTGGGATGCTCCTACATGTCA-TAMRA 200nM

Instrument

CFX 96

        1.3μl QPR303UD13/25μlreaction 
                   Green:-20 Blue:7d at 37℃ 

                
1.5μl Enzyme Mix /25μlreaction
                 
(0.2μl END-UD13 added)

      Green-20 Blue7d at 37

 

     2.5μl Enzyme Mix /25μlreaction

             (1.2μl END-UD13 added)

              Green-20 Blue7d at 37


STORAGE

This reagent can be stored at 4°C for 1 months. For longer storage,  this reagent should be kept at -20°C for 2 years.





 


HOW TO BUY PRODUCTS