DESCRIPTION

TOROIVD^® Probe 1-step RT-qPCR 5G Premix is a fast, single-tube, 2XRT-qPCR mix that provides for sensitive, reproducible detection up to five RNA/DNA targets in a single multiplex reaction. Particularly useful for virus detection with TaqMan^® probe assays, the mix includes thermostable MMLV reverse transcriptase, TOROIVD^® 5G DNA polymerase, dNTPs and reaction buffer all in a single tube. The improved enzymes and reaction mixture combination also enables a high resistance to PCR inhibitors and high stability in room temperature. The 1-step system is suitable for high-throughput analysis because of its simple reaction setup. In addition, this system can reduce the risk of cross-contamination. The premix is suitable for high-speed RT-qPCR and enables accurate detection and quantification of targets, making it possible to obtain highly reproducible and reliable realtime PCR results over a wide dynamic range. 

FEATURES

-Rapid and highly sensitive
This kit can achieve the rapid and highly sensitive quantification of a low-copy targets  by a 1-step RT-qPCR method with probes and be suitable for the quantification of RNA/DNA viruses or mRNA expressed at a low level. 

-Optimized for multiplexing
This kit has been validated for multiplexing up to five targets simultaneously, allowing for additional targets and/or controls to be run simultaneously for efficiency or quality control purposes. 

-Inhibitor tolerant
The unique proprietary formulation of this kit allows robust performance even in the presence of substances that can normally inhibit PCR, such as heparin, hematin, or EDTA, increasing your confidence when working with a variety of complex clinical samples. 

-Wide dynamic range compatible with RNA and DNA
This kit has been optimized to provide high specificity and dynamic range for use with both RNA and DNA targets. This input flexibility can help streamline the number of different workflows in your lab to improve efficiency. 

-Broad instrument compatibility
This kit can be run in either fast or standard cycling conditions with equivalent performance across a wide variety of real-time cyclers. The 50× ROX Reference dye (not supplied) is added can be applied to the real-time cyclers that require a passive reference dye. 

-Utilization of dUTP 

This kit contains dUTP in the reaction Buffer. Therefore, the rate of false-positive detection can be reduced by adding uracil-N-glycosylase (UNG) (not supplied).

Components

The kit includes the following  reagents, and QPR-300 can be used for 250 reactions for a total 40ul reaction volume and QPR-300T for 25 reactions for a total 40ul reaction volume. All reagents should be stored at -20°C. 

Notes:   2×RT-qPCR 5G Premix contains 0.4mM dA/C/G/T/UTP, 5mM Mg²⁺，mutated MMLV reverse transcriptase, TOROIVD^® 5G DNA polymerase，RNase inhibitor，reaction buffer and stabilizer，etc.). 

Primer/probe design 

 -Design of primers ：

Primer length: 18-25bp; GC content of primer: 40–60%;

Tm of primer: 60–65°C; Purification grade: OPC or HPLC grade; Target length: 70–200 bp, Larger targets (>200 bp) tend to reduce the efficiency and specificity of amplification. 

 - Design of  probes：
  -Probe length: 20-30bp; GC content of probe: 40–60%; Tm of probe: 65–70°C; Purification grade of primers: HPLC grade.  

- Checking the performance of primers and probes：

 -Prepare a dilution series with five or more dilutions of template RNA/DNA. Perform RT-qPCR assay using the diluted RNA with the newly designed primers and probe, and draw a standard curve. 

 -Confirm that the PCR efficiency is between 90% and 110% and R2 is equal to or greater than 0.99. if the PCR efficiency or R2 are outside of these ranges, the reaction conditions should be optimized. If this does not improve the result, the primers and/or probe should be redesigned. 

Protocol 

1. This premix should be fully thawed before use. Gently vortexed and briefly centrifuged. 

2. Purified or crude template RNA can be may be used directly or after dilution.

3. Prepare the following reaction mixture in a thin-walled qPCR tube or plate.

4. Gently mix the  reaction solutions  and spin down in microcentrifuge.

Notes： 

 -2.5mM MgCl₂ final concentration have been added in this reaction mixture. But for the direct RT-qPCR to crude template RNA the MgCl₂ concentration may need to be optimized between 2.5-8mM. 
 -The primer concentration should be optimized between 0.2-0.8 μM with the TaqMan^® probe concentration at 0.1μM. Then, the concentration of TaqMan^® probe should be increased up to 0.4 μM in cases in which the increase of primers has not improved the results. Increasing the primer concentration can improve the PCR efficiency in cases in which the annealing of primers is insufficient, and decreasing may improve the efficiency in cases with primer–dimer formation. Similarly, increasing the TaqMan^® probe concentration can increase the sensitivity in cases in which the annealing of TaqMan^® probes is insufficient and a low concentration of TaqMan^® probe of less than 0.1 μM decreases the sensitivity because of low fluorescence intensity. 

 -The 50× ROX is not supplied with this kit. It is recommended that you use 50×ROX (ROX-050) optionally. 50× ROX reference dyes are used for analyses with instruments that correct for cross-talk between wells, such as the real- time PCR instruments by Applied Biosystems and Agilent Technologies. 0.8ul 50×ROX Reference Dye was added for a total 40ul reaction volume in when using the following instruments, Applied Biosystems 7300/ 7700/7900HT, StepOnePlus, etc. And 0.08ul was added for using the following instruments, Applied Biosystems 7500/7500Fast StepOnePlus, Agilent Technologies AriaMx, etc. No ROX Reference Dye is required when using other brand instruments, such as LightCycler 96/LightCycler 480 system (Roche), CFX96 Real-Time PCR Detection System (Bio-Rad), Smart Cycler System (Cepheid), etc.

 -UNG should be used and not supplied with this kit. The added volume is according to the instructions of the manufacturers.

Cycling conditions 

The recommended 2-step PCR protocol is described below. Use this protocol first and optimize PCR conditions when necessary. Perform 3-step PCR when using primers with low Tm values or when 2-step PCR is not feasible.

Notes： 

-[Optional] The UNG treatment step should be added before the reverse transcription step. The indicated temperature and time are  according to the instructions of the manufacturers.

-The indicated RT temperature can be optimized between 50-60°C, and time between 5-15min.

-The indicated Pre-denaturation temperature can be optimized 95-98°C, and time between 10sec-5min.

-The indicated denaturation temperature can be optimized 95-98°C, and time between 3sec-10sec.

-The indicated Extension /Annealing temperature can be optimized 60-65°C, and time between 5sec-31sec.

APPLICATION DATA 

Template RNA:MS2RNA (Roche)

 Forward primer:GCCTTAGCAGTGCCCTGTCT
 Reverse primer:AACATGCTCGAGGGCCTTA
 Taqman Probe:FAM-CCCGTGGGATGCTCCTACATGTCA-TAMRA

 1. Sensitivity comparison with company TB. 

(Instrument: CFX96 from Biorad)                       

 

     (Pink: QPR-300 Green: Company TB)

MS2RNA	QPR-300			Average	∆Cq	SD
1588 copies	26.33	26.79	26.66	26.60	-	0.24
158 copies	30.03	30.30	30.47	30.27	3.67	0.22
15.8 copies	33.65	33.74	33.28	33.56	3.29	0.25
1.58 copies	37.98	37.25	36.33	37.18	3.63	0.83
NTC	-	-	-

 

MS2RNA	Company TB			Average	∆Cq	SD
1588 copies	27.11	26.64	26.44	26.73	-	0.34
158 copies	31.05	31.65	31.03	31.24	4.51	0.36
15.8 copies	34.25	35.22	34.36	34.61	3.37	0.53
1.58 copies	39.05	38.88	40.22	39.38	4.77	0.73
NTC	-	-	-

2. Comparison of the dynamic range and PCR efficiency with company TA

(Instrument: ABI7500)