Evolving Enzymes  

   Inovating IVD

Evolving Enzymes  

   Inovating IVD

MORE
PRODUCT CENTER
TOROGreen® qPCR Master Mix
    Publish time 2018-09-26 15:52    

This product is a Taq DNA polymerase-based 2 x master mix for realtime PCR, which contains all components, except for the primer.  This reagent is applicable for intercalation assay with SYBR Green I. This reagent can be used in glass capillary systems or passive reference system. Hot Start technology with anti-Taq DNA polymerase antibodies enables high specificity and reproducible amplification. 


DESCRIPTION

 

This product is a Taq DNA polymerase-based 2× master mix for realtime PCR, which contains all components, except for the primer.  This reagent is applicable for intercalation assay with SYBR Green I. This reagent can be used in glass capillary systems or passive reference system. Hot Start technology with anti-Taq DNA polymerase antibodies enables high specificity and reproducible amplification.  


COMPONENTS

 

QST-100 can be used for 1000 reactions for a total 20µL reaction volume.

 

Cat NO.

Components

Size

QST-100

2×TOROGreen® qPCR Master Mix  

1 ml ×10tubes/ Kit

 

PRIMER DESIGN

 

- Primer length: 20~30 mer
GC content of primer: 40~80%
-
Target length: ≤ 200 bp (optimally, ≤ 150bp) 

 

SPECIMEN

 

-cDNA :  Reverse transcription reactions from total or poly (A)+ RNA may be used directly, or after dilution, for realtime PCR. Purified RNA by phenol/ chloroform extraction and ethanol precipitation may also be used.  Oligo dT and random primers  are suitable for the reverse transcription reaction.

-Genomic DNA:  Purified DNA, which would be used for general PCR, is also suitable for real-time PCR. In the case of mammalian genomic DNA,  1~10 ng genomic DNA is sufficient for real-time PCR. 


PROTOCOL

 

-This premix should be fully thawed at room temperature in the bags, gently vortexed and briefly centrifuged.
Notes: Due to the high concentration stabilizer,there may be crystal precipitation in the premix ,which can be used normally after being fully thawed at room temperature .

-Purified DNA and RT reactions can be may be used directly or after dilution. 

-In order to reducing the artificial error of sampling, design the plate layout and sampling method by the number of the templates and primer pairs. According to the following two situations,the total reaction is divided into two parts for premixing and loading in the a thin-walled qPCR tube or plate at room temperature.

  Fore more genes and less samples in one plate

Components                20μL reaction ×n  

    Operation

TOROGreen® qPCR Master Mix             10μL×n

Premix and Loading

Template DNA Dilutions                           2μL×n

2μM Forward primer                                4μL×n

Premix and Loading

2μM Reverse primer                                4μL×n

 Fore more samples and less genes in one plate

Components                20μL reaction ×n 

Operation

TOROGreen® qPCR Master Mix               10μL×n

Premix and Loading

8μM Reverse primer            1μL×n

Premix 

8μM Reverse primer            1μL×n

Template DNA Dilutions                             8μL×n

Premix and Loading

-Gently mix the reaction solutions and spin down in microcentrifuge.


CYCLING CONDITIONS
 

2-step PCR protocol 

1

Pre-denaturation

95℃

60 sec

1cycle

2

Denaturation

95°C

10 sec

40

cycles  

Annealing/ Extension

60°C

30 sec

Data collection should be performed at the extension step.  

 

3-step PCR protocol 

1

Pre-denaturation

95℃

60 sec

1cycle

2

Denaturation

95°C

15 sec

40

cycles 

Annealing

55-65°C

15 sec

 Extension

72°C

45 sec

Data collection should be performed at the extension step.  

 

Notes 

-Use this protocol first and optimize PCR conditions when necessary. Perform 3-step PCR when using primers with low Tm values or when 2-step PCR is not feasible. 

-The annealing temperature can be set to 55~65°C, depending on the primer Tm value.
-The annealing time should be set for 5~20 seconds. Longer annealing time results increased efficiency, and a shorter  time decreases non-specific amplification.
-The pre-denaturation condition described above is sufficient  for inactivation of the anti-Taq DNA polymerase  antibodies   used in Hot Start PCR. To prevent unexpected  and inappropriate results, do not prolong the predenaturation period. 
-Data collection step should be longer than 10 sec.
-If commercially available primers or probes are employed, the recommended conditions from each company should  be used. 

 

DETECTION


-This reagent can be used in general detection devices,not needing ROX such as: LineGene(bioer);LightCycler (Roche);iCycler iQ,CFX96(Biorad/MJ); Thermal Cycler Dice(Takara);
-This reagent with 1× ROX can also be used in detection equipment using passive reference, such as:ABI PRISM 7000, 7700, 7900 ,7300;Step One,Step one plus etc.(ABI) ,ABI PRISM  7500, 7500Fast(ABI); Mx3000P,3005P,MX4000,etc.(Agilent).

 

STORAGE


This reagent can be stored at 4°C for 2 months and protected from light. For longer storage,  this reagent should be kept at -20°C and protected from light. 


Example 

Target Gene  :  Bacillus badius phenylalanine dehydrogenase  gene in pET28a plasmid
Primer
 
Forward primer  AGGAAGCCGATGTGTTCGTT 

Reverse primer TTCCGCTTGCTGGTACACTT
Competitor Company T 2×SYBR Green  qPCR Master Mix
Instrument model ABI 7500


 Amplification curve
     
 

 


Melting curve

        



ORDER INFORMATION


Cat NO.

Components

Package

Size

Price

Manual

QST-100

TOROGreen® qPCR Master Mix 

1 ml ×5tubes/ bag; 2bags/kit

1000 reactions  for a total 20μl reaction

US$ 250.00

     




HOW TO BUY PRODUCTS