Evolving Enzymes  

   Inovating IVD

Evolving Enzymes  

   Inovating IVD

MORE
PRODUCT CENTER
TOROGreen® 5G qPCR Premix
    Publish time 2020-02-12 12:26    

TOROGreen®5G qPCR Premix is an 2×Master mix for intercalator-based realtime PCR with SYBRGreen I, which contains all components except for the primer. TOROIVD®5G polymerase 2.0,a mutant hot-start Tth DNA polymerase,allows high specificity and sensitivity for high-speed reactions.The improved PCR enzyme and reaction mixture combination also enables a high resistance to PCR inhibitors. ROX Reference dye is added into the premix and can be applied to the real-time cyclers that require a passive reference dye.A non-fluorescent, visible dye is added into the premix to monitor reaction setup. The premix is suitable for high-speed PCR and enables accurate detection and quantification of targets, making it possible to obtain highly reproducible and reliable realtime PCR results over a wide dynamic range.




DESCRIPTION

TOROGreen®5G qPCR Premix is an 2×Master mix for intercalator-based realtime PCR with SYBRGreen I, which contains all components except for the primer. TOROIVD®5G polymerase 2.0,a mutant hot-start Tth DNA polymerase,allows high specificity and sensitivity for high-speed reactions.The improved PCR enzyme and reaction mixture combination also enables a high resistance to PCR inhibitors. ROX Reference dye is added into the premix and can be applied to the real-time cyclers that require a passive reference dye.A non-fluorescent, visible dye is added into the premix to monitor reaction setup. The premix is suitable for high-speed PCR and enables accurate detection and quantification of targets, making it possible to obtain highly reproducible and reliable realtime PCR results over a wide dynamic range.

FEATURES


-High-speed

TOROIVD®5G polymerase 2.0 enables a high speed PCR reactions using the fast cycling conditions.
-Inhibitor tolerant

The unique proprietary formulation of this kit allows robust performance even in the presence of substances 

that can normally inhibit PCR, such as heparin, hematin, or EDTA.

-Wide dynamic range
This kit has been optimized to provide high specificity and wide dynamic range for gene expression analysis.

- High specificity
Hot start technology with a novel modifying reagent high specificity and reproducible amplification.


COMPONENTS

 

QST-300 can be used for 1000 reactions for a total 20µL reaction volume.

 

Cat NO.

Components

Size

QST-300

2×TOROGreen® 5G qPCR Premix

1.25 ml × 8tubes/ Kit


PRIMER DESIGN

 

- Primer length: 20~30 mer
GC content of primer: 40~60%
-Target length: ≤ 200 bp (optimally, ≤ 150bp) 

 

SPECIMEN

 

-cDNA :  Reverse transcription reactions from total or poly (A)+RNA may be used directly, orafter dilution, for realtime PCR. Purified cDNA by phenol/ chloroform extraction and ethanol precipitation may also be used.  Oligo dT and random primers  are suitable for the reverse transcription reaction.

-Genomic DNA:  Purified DNA, which would be used for general PCR, is also suitable for real-time PCR. In the case of mammalian genomic DNA,  1~10 ng genomic DNA is sufficient for real-time PCR. 


PROTOCOL

 

-This premix should be fully thawed at room temperature in the light-proof bags, gently vortexed and briefly centrifuged.

Notes: Due to the high concentration stabilizer,there may be crystal precipitation in the premix ,which can be used normally after being fully thawed at room temperature .

-Purified DNA can be may be used directly or after dilution. RT reactions from total RNA may be used after ≥5 times dilutions and the volume should be no more than 10% of the qPCR mixture.

-In order to reducing the artificial error of sampling, design the plate layout and sampling method by the number of the templates and primer pairs.

-According to the following two situations,the total reaction is divided into two parts for premixing and loading in the a thin-walled qPCR tube or plate at room temperature.

  Fore more genes and less samples in one plate

Components                     20μL reaction ×n  

    Operation

TOROGreen® 5G qPCR Premix                 10μL×n

Premix and Loading

Template DNA Dilutions                           2μL×n

2μM Forward primer                                4μL×n

Premix and Loading

2μM Reverse primer                                4μL×n






Fore more samples and less genes in one plate

Components                20μL reaction ×n 

Operation

TOROGreen® 5G qPCR Premix                   10μL×n

Premix and Loading

8μM Reverse primer            1μL×n

Premix 

8μM Reverse primer            1μL×n

Template DNA Dilutions                             8μL×n

Premix and Loading







-Gently mix the  reaction  solutions  and  spin down in microcentrifuge.


CYCLING CONDITIONS
 

The recommended 2-step PCR protocol is described below

 

For Bio-Rad CFX96,etc.

1

Pre-denaturation

95℃

5min

1

2

Denaturation

98°C

3 sec

40

Annealing/ Extension

60°C

5 sec

Data collection should be performed at the extension step.  

 

 For ABI StepOne Plus,etc.

1

Pre-denaturation

95℃

5min

1

2

Denaturation

98°C

3 sec

40

Annealing/ Extension

60°C

10 sec

Data collection should be performed at the extension step.  

 

 For Bioer LineGene 9600 Plus Roche LightCycler 96 / 480 systems,etc.

1

Pre-denaturation

95℃

5min

1

2

Denaturation

95°C

10 sec

40

Annealing/ Extension

60°C

20 sec

Data collection should be performed at the extension step.  

 

 For ABI 7500/7300 etc.

1

Pre-denaturation

95℃

5min

1

2

Denaturation

95°C

10 sec

40

Annealing/ Extension

60°C

30 sec

Data collection should be performed at the extension step.  

 
Notes: 

-Use this protocol first and optimize PCR conditions when necessary. Perform 3-step PCR when using 

primers with low Tm values or when 2-step PCR is not feasible. 

-The indicated pre-denaturation temperature can be optimized 95-98°C,and time between 10sec-5min.

-The indicated denaturation temperature can be optimized 95-98°C,and time between 3sec-10sec.

-The indicated Extension /Annealing temperature can be optimized 60-65°C,and time between 5sec-30ec.

 

APPLICATION DATA

 

Target Gene :  Bacillus badius phenylalanine dehydrogenase gene in pET28a plasmid

Forward primer: AGGAAGCCGATGTGTTCGTT
Reverse primer: TTCCGCTTGCTGGTACACTT

Instrument:  CFX96 (BioRad)

1 .Amplification Curve



2. Standard Curve



3Melt Curve

 

 


STORAGE

 

This kit should be kept at -20°C and protected from light.

 



ORDER INFORMATION 


Cat NO.

Components

Package

Size

Price

Manual

QST-300

TOROGreen® 5G qPCR Premix

1.25 ml ×4tubes/ bag; 2bags/kit

1000 reactions  for a total 20μL reaction

US$ 300

  
Bulk package can be supplied,please contact us .

HOW TO BUY PRODUCTS